Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACOT8

Gene ID (NCBI) 10005
Gene Symbol ACOT8
Protein Name acyl-CoA thioesterase 8
Synonyms HNAACTE|PTE-1|PTE-2|PTE1|PTE2|hACTE-III|hTE
Databases KEGG link 01 |  NCBI Gene link 01


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR046147 ARe15G03 pKA1U5 NM_005469.2
GGCCGGAAGAGTCAGGTTCTGTGTATGTCTCCNCGTTCTTCCGCGGAGCGGGTGTGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl