Prev. |  Human A to Z list >  G >  GATA6 > 

ARe07G01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR042945
Clone Name ARe07G01
Clone info. Plasmid clone of human GATA6 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGCTCGCTGAGCGCAGTTCCGACCCACAGCCTGGCACCCTTCGGCGAGCGCTGTTTGTTT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_005257.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) GATA6 (NCBI Gene 2627)  other clone of GATA6 in our bank
Synonyms -
Protein Name GATA binding protein 6
KEGG hsa:2627
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR042945 ARe07G01 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe07G01a.seq       ARe07G01.pdf

References and tips

Featured content

Reference

user report Tomizawa, M., Transcription Factors and Medium Suitable for Initiating the Differentiation of Human Induced Pluripotent Stem Cells to the Hepatocyte Lineage. J. Cell. Biochem. 117 (9): 2001-2009 (2016). PMID 26773721.

2018.10.13

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl