Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GATA6

Gene ID (NCBI) 2627
Gene Symbol GATA6
Protein Name GATA binding protein 6
Synonyms -
Databases KEGG hsa:2627 |  NCBI Gene 2627
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17897)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042945 ARe07G01 pKA1U5 NM_005257.3 done
GGCTCGCTGAGCGCAGTTCCGACCCACAGCCTGGCACCCTTCGGCGAGCGCTGTTTGTTT
HKR205382 ARiS013H14 pGCAP10 NM_005257.3  
GGGNCTCGCGCTCCCCCGCTGGCGCCCTCGGCTTCTCTCCGCGCCTGGGAGCACCCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl