Prev. | 

RIKEN DNA Bank Human Resource - EPOP

Gene ID NCBI Gene 100170841 |  KEGG hsa:100170841
Gene Symbol EPOP
Protein Name elongin BC and polycomb repressive complex 2 associated protein
Synonyms C17orf96|PRR28
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058033 ARe45B09 pKA1U5 NM_001130677.1  
GAGCCAGCGGGGAAGAAAGAAACCGAGCGGGCGGAAGGCGCCCTCCCCGCCGCCTGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl