Prev. |  Human A to Z list >  E >  EPOP > 

ARe45B09 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR058033
Clone Name ARe45B09
Clone info. Plasmid clone of human C17orf96 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GAGCCAGCGGGGAAGAAAGAAACCGAGCGGGCGGAAGGCGCCCTCCCCGCCGCCTGGGCC
Sequence, submitted(2) AB371483 [link]
 
Sequence, refered NM_001130677.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) EPOP (NCBI Gene 100170841)  other clone of EPOP in our bank
Synonyms C17orf96|PRR28
Protein Name elongin BC and polycomb repressive complex 2 associated protein
KEGG hsa:100170841
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR058033 ARe45B09 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.05.24

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl