Prev. | 

RIKEN DNA Bank Human Resource - MAP4K3-DT

Gene ID NCBI Gene 728730 |  KEGG hsa:728730
Gene Symbol MAP4K3-DT
Protein Name MAP4K3 divergent transcript
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325681 RBb14D09 pKA1U5 XM_001132276.1  
GGTTCCGGCTCCGCGCGCCTGCCAGGCCGGGGCCGGCGGCGGAACAGCTTGGGACCCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl