Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LOC728730

Gene ID (NCBI) 728730
Gene Symbol LOC728730
Protein Name uncharacterized LOC728730
Synonyms -
Databases KEGG hsa:728730 |  NCBI Gene 728730


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325681 RBb14D09 pKA1U5 XM_001132276.1  
GGTTCCGGCTCCGCGCGCCTGCCAGGCCGGGGCCGGCGGCGGAACAGCTTGGGACCCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl