Prev. |  Human A to Z list >  L >  LOC728730 > 

RBb14D09 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR325681
Clone Name RBb14D09
Clone info. Plasmid clone of human LOC728730 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGTTCCGGCTCCGCGCGCCTGCCAGGCCGGGGCCGGCGGCGGAACAGCTTGGGACCCGAA
Sequence, submitted(2) n.a.
 
Sequence, refered XM_001132276.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) LOC728730 (NCBI Gene 728730)  other clone of LOC728730 in our bank
Synonyms -
Protein Name uncharacterized LOC728730
KEGG hsa:728730
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR325681 RBb14D09 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.05.24

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl