Prev. |  KEGG KO K17784 > 

RIKEN DNA Bank Human Resource - MINOS1

Gene ID NCBI Gene 440574 |  KEGG hsa:440574
Gene Symbol MINOS1
Protein Name mitochondrial inner membrane organizing system 1
Synonyms C1orf151|MIO10|Mic10
Ortholog resources KEGG ortholog (KEGG orthology K17784) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084776 IRAL011P16 pOTB7 BC009927 NM_001032363 Full/var
HGY103156 IRAL057O20 pDNR-LIB BC070388 NM_001032363 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082811 M01C007A11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE082859 M01C007C11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE082907 M01C007E11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE082955 M01C007G11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE083003 M01C007I11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE083051 M01C007K11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE083099 M01C007M11 pDONR221 FLJ01-A06 AK094318 NM_001032363  
HGE083147 M01C007O11 pDONR221 FLJ01-A06 AK094318 NM_001032363  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068483 ARe71D11 pKA1U5 NM_001032363.1  
GCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATGTCTGAGTCGGAGCTCGGCAGGAAG
HKR179769 ARi49H01 pGCAP10 NM_001032363.1  
GAGGAAAGCTGGAGGCGCGGGTGGGGAACATGTCTGAGTCGGAGCTCGGCAGGAAGTGGG
HKR187626 ARi69B02 pGCAP10 NM_001032363.1  
GAGGCGCGGGTGGGGAACATGTCTGAGTCGGAGCTCGGCAGGAAGTGGGACCGGTGTCTG
HKR234901 ARiS087E05 pGCAP10 NM_001032363.1  
GCGGAGCNCGGGGGCCGGCCGANAGGAAAGCTGGAGGCGCGGGTGGGGAACATGTCTGAG
HKR338902 RBb47E06 pGCAP1 NM_001032363.1  
GAGGGGTCGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATG
HKR362053 RBd05C05 pGCAP10 NM_001032363.1  
GAGGGGTCGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATG
HKR376577 RBd41H09 pGCAP10 NM_001032363.1  
GGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATGTCTGAGT
HKR391604 RBd79A04 pGCAP10 NM_001032363.1  
GGCGGGTGGGGAACATGTCTGAGTCGGAGCTCGGCAGGAAGTGGGACCGGTGTCTGGCGG
HKR432734 RBdS081N22 pGCAP10 NM_001032363.1  
GGAGACTTTCAGGGGTCGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTG
HKR462637 RBdS156J21 pGCAP10 NM_001032363.1  
GAGGGGTCGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl