Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156J21

Clone ID RBdS156J21
HP ID HP04288
Gene ID 440574
Gene Symbol C1orf151
Protein Name chromosome 1 open reading frame 151
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001032363.1
Length of RefSeq (bp) 2589
Chromosome 1p36.13
Reference DDBJ accession
UniGene Hs.466662
5'-terminal sequence GAGGGGTCGGAGCGCGGGGGCCGGCCGAGAGGAAAGCTGGAGGCGCGGGTGGGGAACATG
2011.08.28