Prev. | 

RIKEN DNA Bank Human Resource - C4orf48

Gene ID NCBI Gene 401115 |  KEGG hsa:401115
Gene Symbol C4orf48
Protein Name chromosome 4 open reading frame 48
Synonyms CHR4_55
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031380 IRAK078H12 pCMV-SPORT6 BC038466 XM_937968 Partial
HGX037404 IRAK093I12 pCMV-SPORT6 BC047038 XM_937968 Partial/var
HGY100656 IRAL051K16 pDNR-LIB BC062790 XM_937968 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049607 ARe24A07 pKA1U5 NM_001141936.2  
GGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGAAC
HKR054430 ARe36B06 pKA1U5 NM_001141936.2  
GGGACGCGGCAACGTCTGCCGGNTGTCCCCGCGCCTGCATGGATCCCGGGGTCCCATGAA
HKR060006 ARe50A06 pKA1U5 NM_001141936.2  
TAGAGTGCTAGAGCTCTCGACTCTCCGCTGCGCGGCAGCTGGCGGGGGGAGCAGCCAGGT
HKR060173 ARe50H05 pKA1U5 NM_001141936.2  
TGGCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGTAACCGCGGGCGGCCCCGCTCCC
HKR168955 ARi22G11 pGCAP10 NM_001141936.2  
GGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGAACCGCGGGCGGCCCCGCT
HKR182880 ARi57D08 pGCAP10 NM_001141936.2  
TGGGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTC
HKR234863 ARiS087C15 pGCAP10 NM_001141936.2  
GGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCC
HKR325753 RBb14G09 pKA1U5 NM_001141936.2  
TGGCTGAACCGCGGTAAGGGCGGTGGTGCGGGCGTCCGAATGGGCGTTTTCTAGATACGG
HKR327776 RBb19H08 pKA1U5 NM_001141936.2  
TTGGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGA
HKR331380 RBb28H12 pGCAP1 NM_001141936.2  
GGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGTAACCGCGGGCGGCCCCGC
HKR339756 RBb49G12 pGCAP1 NM_001141936.2  
GGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCATGCATGGCTCNNGGGGTCCCTGAA
HKR340575 RBb51H07 pGCAP1 NM_001141936.2  
GGGGGTCCCTGNAACCGCGGNTAAGGGCGGTGGTGCGGGCGTCCGAATGGGCGTTTTCTA
HKR388003 RBd70A03 pGCAP10 NM_001141936.2  
GGCGCGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGG
HKR392908 RBd82E12 pGCAP10 NM_001141936.2  
GGCGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTC
HKR430058 RBdS075C10 pGCAP10 NM_001141936.2  
GGCGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTC
HKR441624 RBdS104A24 pGCAP10 NM_001141936.2  
TGGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTCCCTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl