Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075C10

Clone ID RBdS075C10
HP ID HP04309
Gene ID 401115
Gene Symbol C4orf48
Protein Name chromosome 4 open reading frame 48
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001141936.2
Length of RefSeq (bp) 483
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.446474
5'-terminal sequence GGCGTTGCGCGCCGGACGCGGAACGTCTGCCGGTGTCCCCGCGCTGCTGGTCCCGGGGTC
2011.08.28