Prev. |  KEGG KO K20399 > 

RIKEN DNA Bank Human Resource - LAMTOR4

Gene ID NCBI Gene 389541 |  KEGG hsa:389541
Gene Symbol LAMTOR4
Protein Name late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Synonyms C7orf59
Ortholog resource in our bank

  LAMTOR4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076429 ARe91B05 pKA1U5 NM_001008395.2 done
GCTGAAGCCGGAAGCTACCTATCTGGTAGGGAGCTCCCCCAGCACCGAAGACTGCGATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl