Prev. |  Human A to Z list >   >   > 

ARe91B05 - NRCD Human cDNA Clone

Catalog Number HKR076429
Clone Name ARe91B05
Clone info. Plasmid clone of human C7orf59 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GCTGAAGCCGGAAGCTACCTATCTGGTAGGGAGCTCCCCCAGCACCGAAGACTGCGATGA
Sequence, submitted(3) n.a.
Note match to NM_001008395.4 (1-594) CDS:full/var
 
Sequence, refered NM_001008395.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4)  (NCBI Gene 389541)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR076429 ARe91B05 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe91B05a.seq   ARe91B05c.seq ARe91B05z.seq ARe91B05.pdf

References and tips

Featured content

Reference


2022.03.18

NRCDhumcloneList_AR_210404.csv - DataSheet_NRCD_html_210920.pl