DNA Bank Top |  KEGG KO K01530 > 

RIKEN DNA Bank Human Resource - ATP9B

Gene ID NCBI Gene 374868 |  KEGG hsa:374868
Gene Symbol ATP9B
Protein Name ATPase phospholipid transporting 9B (putative)
Synonyms ATPASEP|ATPIIB|HUSSY-20|NEO1L|hMMR1

Link

Ortholog resource in our bank

  ATP9B


External database

human ATP9B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18732 human ATP9B Retroviral expression vector of human ATP9B.    
RDB20136 pCAG/ATP9B-HA Expression vector of human ATP9B for mammalian cells, C-terminal HA-tag.    
RDB20153 pMx/ATP9B-HA Retroviral vector for expression of human ATP9B in mammalian cells, C-terminal HA-tag.    
RDB20167 pCAG/ATP9B(E272Q)-HA Expression vector of human ATP9B ATPase-deficient mutant (E272Q) for mammalian cells, C-terminal HA-tag.    
RDB20179 pMx/ATP9B(E272Q)-HA Retroviral vector for expression of human ATP9B ATPase-deficient mutant (E272Q) in mammalian cells, C-terminal HA-tag.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046311 IRAK115M23 pCMV-SPORT6 BC053561 NM_198531 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442243 RBdS105K03 pGCAP10 NM_198531.3  
GGTCGGAACATGGCGGACCAGATCCCGCTTTACCCGGTGCGTAGCGCAGCGGCGGCCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.07

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl