Prev. |  Human A to Z list >  A >  ATP9B > 

NRCD Human cDNA Clone - RBdS105K03

Ordering information ordering information
Catalog Number HKR442243
Clone Name RBdS105K03
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGTCGGAACATGGCGGACCAGATCCCGCTTTACCCGGTGCGTAGCGCAGCGGCGGCCGCA
Sequence, submitted(2) Not available.
Description Plasmid clone of human ATP9B cDNA with SV40 promoter
 
HP ID HP08380  finder other clones in this HP group.
Sequence, refered (NCBI RefSeq mRNA) NM_198531.3
Gene ID 374868
Gene Symbol ATP9B  finder other clones with this gene.
Protein Name ATPase, class II, type 9B
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.


2015.02.02

J:\Perl_src_\csv_set\NRCDhumcloneList_RB_140122.csv - GNP_filter3_NRCD_html_141023.pl