Prev. |  KEGG KO K12375 > 

RIKEN DNA Bank Human Resource - ARSI

Gene ID NCBI Gene 340075 |  KEGG hsa:340075
Gene Symbol ARSI
Protein Name arylsulfatase family member I
Synonyms ASI|SPG66
Ortholog resource in our bank

  ARSI

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040553 ARe01G09 pKA1U5 NM_001012301.4 full cds done
GCCCTCCACCTGGGGCTCGGCCCGGCCCGGCACATGTTACAACTTTTTCGAATTCTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl