Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARSI

Gene ID (NCBI) 340075
Gene Symbol ARSI
Protein Name arylsulfatase family member I
Synonyms ASI|SPG66
Databases KEGG hsa:340075 |  NCBI Gene 340075
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12375)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040553 ARe01G09 pKA1U5 NM_001012301.2  
GCCCTCCACCTGGGGCTCGGCCCGGCCCGGCACATGTTACAACTTTTTCGAATTCTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl