ARe01G09 - NRCD Human cDNA Clone

Catalog Number HKR040553 Clone Name ARe01G09 Clone info. Plasmid clone of human ARSI cDNA with SV40 promoter Vector Click for information pKA1U5 5'-terminal sequence(1) GCCCTCCACCTGGGGCTCGGCCCGGCCCGGCACATGTTACAACTTTTTCGAATTCTCTCC Sequence, submitted(2) AB448735 [link]   Sequence, refered NM_001012301.2 (NCBI RefSeq mRNA) Gene Symbol and ID(3) ARSI (NCBI Gene 340075)  other clone of ARSI in our bank Synonyms ASI|SPG66 Protein Name arylsulfatase family member I

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2020.06.29