Prev. | 

RIKEN DNA Bank Human Resource - C17orf51

Gene ID NCBI Gene 339263 |  KEGG hsa:339263
Gene Symbol C17orf51
Protein Name chromosome 17 open reading frame 51
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004936 IRAK012F16 pCMV-SPORT6 BC010612 XM_944416 Full
HGX010524 IRAK026F04 pCMV-SPORT6 BC019938 XM_944416 Full
HGX011855 IRAK029K15 pCMV-SPORT6 BC040371 XM_944416 Partial/var
HGY042518 IRAK106E22 pBluescript BC052777 XM_944416 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243929 ARiS109N17 pGCAP10 NM_001113434.2  
GGGCCGGCGTGGCTGGCTGTTTGAGGACTGCGCGCGGAGCTCCGTGGCGGGTGTCTGAAG
HKR442273 RBdS105L09 pGCAP10 NM_001113434.2  
GGTGCGCCCGGCCGGCGTGGCTGGCTGTTTGAGGACTGCGCGCGGAGCTCCGTGGCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl