Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105L09

Clone ID RBdS105L09
HP ID HP07438
Gene ID 339263
Gene Symbol C17orf51
Protein Name chromosome 17 open reading frame 51
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001113434.2
Length of RefSeq (bp) 3587
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.514016
5'-terminal sequence GGTGCGCCCGGCCGGCGTGGCTGGCTGTTTGAGGACTGCGCGCGGAGCTCCGTGGCGGGT
2011.08.28