Prev. | 

RIKEN DNA Bank Human Resource - H2BC20P

Gene ID NCBI Gene 337873 |  KEGG hsa:337873
Gene Symbol H2BC20P
Protein Name H2B clustered histone 20, pseudogene
Synonyms H2B/t|HIST2H2BC|HIST2H2BD
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR399656 RBd99C08 pGCAP10   done
GAGACCCCGAGCCTACCGCTCTGCTTGCGTTCTCGGGGGTCGGTGTCGGTCTTGGGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl