Prev. |  Human A to Z list >   >   > 

RBd99C08 - NRCD Human cDNA Clone

Catalog Number HKR399656
Clone Name RBd99C08
Clone info. Plasmid clone of human HIST2H2BC cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GAGACCCCGAGCCTACCGCTCTGCTTGCGTTCTCGGGGGTCGGTGTCGGTCTTGGGTCTG
Sequence, submitted(2) n.a.
Note (non-cording RNA) match to NR_036461.1 (1-582) .
 
Sequence, refered
Gene Symbol and ID(3)  (NCBI Gene 337873)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR399656 RBd99C08 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBd99C08a.seq   RBd99C08c.seq RBd99C08z.seq RBd99C08.pdf

References and tips

Featured content

Reference


2021.08.31

NRCDhumcloneList_RB_210404.csv - DataSheet_NRCD_html_200831.pl