Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C17orf89

Gene ID (NCBI) 284184
Gene Symbol C17orf89
Protein Name chromosome 17 open reading frame 89
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY103909 IRAL059M21 pOTB7 BC079831 XM_946242 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041626 ARe04B02 pKA1U5 NM_001086521.1
GACGGACCTAAGATGGCGGCCTCCAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGG
HKR167225 ARi18B01 pGCAP10 NM_001086521.1
GAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAA
HKR384908 RBd62E12 pGCAP10 NM_001086521.1
GGAATAGCCGCTCATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCG
HKR394049 RBd85C01 pGCAP10 NM_001086521.1
GGGACCTAAGATGGCGGCCTCTAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGGAG
HKR442244 RBdS105K04 pGCAP10 NM_001086521.1
ATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCGCGCCTTCCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.09

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl