Prev. | 

RIKEN DNA Bank Human Resource - NDUFAF8

Gene ID NCBI Gene 284184 |  KEGG hsa:284184
Gene Symbol NDUFAF8
Protein Name NADH:ubiquinone oxidoreductase complex assembly factor 8
Synonyms C17orf89
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103909 IRAL059M21 pOTB7 BC079831 XM_946242 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041626 ARe04B02 pKA1U5 NM_001086521.1  
GACGGACCTAAGATGGCGGCCTCCAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGG
HKR167225 ARi18B01 pGCAP10 NM_001086521.1  
GAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAA
HKR384908 RBd62E12 pGCAP10 NM_001086521.1  
GGAATAGCCGCTCATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCG
HKR394049 RBd85C01 pGCAP10 NM_001086521.1  
GGGACCTAAGATGGCGGCCTCTAGGGGGCTGGGAATAGCCGCTCATGTCGGCTAACGGAG
HKR442244 RBdS105K04 pGCAP10 NM_001086521.1  
ATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCGCGCCTTCCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl