Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105K04

Clone ID RBdS105K04
HP ID HP10607
Gene ID 284184
Gene Symbol C17orf89
Protein Name chromosome 17 open reading frame 89
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001086521.1
Length of RefSeq (bp) 560
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.356545
5'-terminal sequence ATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCGCGCCTTCCCCGAG
2011.08.28