Prev. | 

RIKEN DNA Bank Human Resource - SKA1

Gene ID NCBI Gene 220134 |  KEGG hsa:220134
Gene Symbol SKA1
Protein Name spindle and kinetochore associated complex subunit 1
Synonyms C18orf24
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006146 IRAK015G02 pCMV-SPORT6 BC015706 NM_145060 Full
HGY093457 IRAL033K17 pOTB7 BC015606 NM_145060 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324951 RBb12G07 pKA1U5 NM_145060.3  
GGTGCGCCTGCGCTGCGCTAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGAGTCCCG
HKR344008 RBb60A08 pGCAP1 NM_145060.3  
AAAACCGGGAACAGCGGCTGAGCCTGCGCTTCGGAAGCATGGATGTGCGCCTGCGCTGCG
HKR365651 RBd14C03 pGCAP10 NM_145060.3  
GAGAGTCCCGTCTCACCATCCTGGGCTTCCAACGGAGACTGCGGTATCCGCGGCTGGAGA
HKR372501 RBd31E05 pGCAP10 NM_145060.3  
GAGAGTCCCGTCTCACCATCCTGGGCTTCCAACGGAGACTGCGGTATCCGCGGCTGGAGA
HKR376931 RBd42F11 pGCAP10 NM_145060.3  
GGTGCGCCTGCGCTGCGCTAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGAGTCCCG
HKR395281 RBd88D09 pGCAP10 NM_145060.3  
GCTCACCATCCTGGGCTTCCAACGGAGACTGCGGTATCCGCGGCTGGAGACCCAGCGGCG
HKR396501 RBd91E05 pGCAP10 NM_145060.3  
GAGAGTCCCGTCTCACCATCCTGGGCTTCCAACGGAGACTGCGGTATCCGCGGCTGGAGA
HKR406329 RBdS015N17 pGCAP10 NM_145060.3  
GAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGAGTCCCGTCTCACCATCCTGGGCTT
HKR416086 RBdS040D14 pGCAP10 NM_145060.3  
GGTGCGCCTGCGCTGCGCTAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGAGTCCCG
HKR420418 RBdS051A18 pGCAP10 NM_145060.3  
GATGGATGTGCGCCTGCGCTGCGCTAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGA
HKR461902 RBdS154M14 pGCAP10 NM_145060.3  
GCTGCGCTTCGGAAGCATGGATGTGCGCCTGCGCTGCGCTAGGGCGCGGCGGGCGGTTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl