Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015N17

Clone ID RBdS015N17
HP ID HP05324
Gene ID 220134
Gene Symbol C18orf24
Protein Name chromosome 18 open reading frame 24
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_145060.3
Length of RefSeq (bp) 2893
Chromosome 18q21.1
Reference DDBJ accession
UniGene Hs.134726
5'-terminal sequence GAGGGCGCGGCGGGCGGTTTGAATTTTGCTTACAGAGTCCCGTCTCACCATCCTGGGCTT
2011.08.28