Prev. |  KEGG KO K15360 > 

RIKEN DNA Bank Human Resource - CENPX

Gene ID NCBI Gene 201254 |  KEGG hsa:201254
Gene Symbol CENPX
Protein Name centromere protein X
Synonyms CENP-X|D9|FAAP10|MHF2|STRA13
Ortholog resource in our bank

  CENPX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086116 IRAL015E20 pOTB7 BC011610 NM_144998 Partial/var
HGY088496 IRAL021D24 pDNR-LIB BC009571 NM_144998 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096442 M01C041B18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096490 M01C041D18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096538 M01C041F18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096586 M01C041H18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096634 M01C041J18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096682 M01C041L18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096730 M01C041N18 pDONR221 MGC10-D09 BC009571 NM_144998  
HGE096778 M01C041P18 pDONR221 MGC10-D09 BC009571 NM_144998  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073680 ARe84D08 pKA1U5 NM_144998.2  
GGGGCGCGCGTTGAGGCTGCGGTCATGGAGGGAGCAGGAGCTGGATCCGGCTTCCGGAAG
HKR182901 ARi57E05 pGCAP10 NM_144998.2  
GGGGGTTCCGGTGGGCGCGCGTTGAGGCTGCGGTCATGGAGGGAGCAGGAGCTGGATCCG
HKR406115 RBdS015E19 pGCAP10 NM_144998.2  
GGCGTTGAGGCTGCGGTCATGGAGGGAGCAGGAGCTGGATCCGGCTTCCGGAAGGAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl