Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015E19

Clone ID RBdS015E19
HP ID HP02158
Gene ID 201254
Gene Symbol STRA13
Protein Name stimulated by retinoic acid 13 homolog (mouse)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_144998.2
Length of RefSeq (bp) 863
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.37616
5'-terminal sequence GGCGTTGAGGCTGCGGTCATGGAGGGAGCAGGAGCTGGATCCGGCTTCCGGAAGGAGCTG
2011.08.28