Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MCMDC2

Gene ID (NCBI) 157777
Gene Symbol MCMDC2
Protein Name minichromosome maintenance domain containing 2
Synonyms C8orf45
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY100601 IRAL051I09 pDNR-LIB BC063108 NM_173518 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR040948 ARe02G04 pKA1U5 NM_173518.4
GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
HKR370857 RBd27C09 pGCAP10 NM_173518.4
GCTTTTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCC
HKR338831 RBb47B07 pGCAP1 NM_173518.4
GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAANAGCCGTTAGTCATGCCGGT
HKR340576 RBb51H08 pGCAP1 NM_173518.4
GCTTTCCCGCGCGACCGGCGTAGGGAGGAAGAAGCGCGAAGAGCCGTTTAGTCATGCCGG
HKR381274 RBd53D02 pGCAP10 NM_173518.4
GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
HKR381722 RBd54F02 pGCAP10 NM_173518.4
GCTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCNNTAGTCATGCCGGTG
HKR388878 RBd72D06 pGCAP10 NM_173518.4
GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
HKR395259 RBd88C11 pGCAP10 NM_173518.4
CGCTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
HKR396097 RBd90E01 pGCAP10 NM_173518.4
GCTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTG
HKR396121 RBd90F01 pGCAP10 NM_173518.4
GCTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTG
HKR397230 RBd93B06 pGCAP10 NM_173518.4
GGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTGTGGTGGCGGCG
HKR405474 RBdS013L10 pGCAP10 NM_173518.4
GGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTGTGGTGGCGGCG
HKR416128 RBdS040F08 pGCAP10 NM_173518.4
GCCTTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCG
HKR420444 RBdS051B20 pGCAP10 NM_173518.4
GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
HKR462728 RBdS156N16 pGCAP10 NM_173518.4
GNTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTG
HKR470918 RBdS177E22 pGCAP10 NM_173518.4
GGCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGG
HKR470936 RBdS177F16 pGCAP10 NM_173518.4
GCTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl