Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051B20

Clone ID RBdS051B20
HP ID HP10510
Gene ID 157777
Gene Symbol C8orf45
Protein Name chromosome 8 open reading frame 45
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_173518.4
Length of RefSeq (bp) 5114
Chromosome 8q13.1
Reference DDBJ accession
UniGene Hs.437006
5'-terminal sequence GCTTTTCCCGCGCGACCGGCGAGGGAGGAAGAAGCGCGAAGAGCCGTTAGTCATGCCGGT
2011.08.28