Prev. | 

RIKEN DNA Bank Human Resource - ANKRD46

Gene ID NCBI Gene 157567 |  KEGG hsa:157567
Gene Symbol ANKRD46
Protein Name ankyrin repeat domain 46
Synonyms ANK-S|GENX-115279
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039456 IRAK098K16 pCMV-SPORT6 BC050396 NM_198401 Partial
HGY053340 IRAK133F20 pBluescript BC060843 NM_198401 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038671 W01A096L07 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE038679 W01A096L15 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE038685 W01A096L21 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE038687 W01A096L23 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE047782 W01A119H14 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE047784 W01A119H16 pENTR-TOPO IRAK098K16 BC050396 NM_198401  
HGE047788 W01A119H20 pENTR-TOPO IRAK098K16 BC050396 NM_198401  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331369 RBb28H01 pGCAP1 NM_198401.2  
GCTCCTTGAAGCTGCCGCTGTCGCTGCTGCTCGTTCGAGTCGCAGATCCTTGCCAGCACA
HKR430262 RBdS075K22 pGCAP10 NM_198401.2  
GGCCTCCTTGAAGCTGCCGCTGTCGCTGCTGCTCGTTCGAGTCGCAGATCCTTGCCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl