Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075K22

Clone ID RBdS075K22
HP ID HP06689
Gene ID 157567
Gene Symbol ANKRD46
Protein Name ankyrin repeat domain 46
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_198401.2
Length of RefSeq (bp) 2800
Chromosome 8q22.3
Reference DDBJ accession
UniGene Hs.530199
5'-terminal sequence GGCCTCCTTGAAGCTGCCGCTGTCGCTGCTGCTCGTTCGAGTCGCAGATCCTTGCCAGCA
2011.08.28