Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARL6IP6

Gene ID (NCBI) 151188
Gene Symbol ARL6IP6
Protein Name ADP-ribosylation-like factor 6 interacting protein 6
Synonyms AIP-6|PFAAP1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY018982 IRAK047H14 pBluescriptR BC028741 NM_152522 Full
HGY102916 IRAL057E20 pDNR-LIB BC070140 NM_152522 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR169373 ARi23H05 pGCAP10 NM_152522.4
GCTCCGCGGGTTTCGTTGTGTTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGG
HKR390576 RBd76H08 pGCAP10 NM_152522.4
GTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGGCTCTGCGGCGCCGCGGTCCC
HKR430005 RBdS075A05 pGCAP10 NM_152522.4
GCTCCGCGGGTTTCGTTGTGTTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.08

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl