Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075A05

Clone ID RBdS075A05
HP ID HP07104
Gene ID 151188
Gene Symbol ARL6IP6
Protein Name ADP-ribosylation-like factor 6 interacting protein 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_152522.4
Length of RefSeq (bp) 2817
Chromosome 2q23.3
Reference DDBJ accession
UniGene Hs.718420
5'-terminal sequence GCTCCGCGGGTTTCGTTGTGTTTCGCGCCATGTCGTTTGCTGAGAGCGGGTGGCGGTCGG
2011.08.28