Prev. |  KEGG KO K17759 > 

RIKEN DNA Bank Human Resource - NAXE

Gene ID NCBI Gene 128240 |  KEGG hsa:128240
Gene Symbol NAXE
Protein Name NAD(P)HX epimerase
Synonyms AIBP|APOA1BP|PEBEL|YJEFN1
Ortholog resources KEGG ortholog (KEGG orthology K17759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047608 IRAK119A08 pCMV-SPORT6 BC056917 NM_144772 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049722 ARe24F02 pKA1U5 NM_144772.2  
GGGGCCGGGGGCGCGCGCTCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTC
HKR064855 ARe62C07 pKA1U5 NM_144772.2  
ATCCTGGGCTCTGCGAGCTGGATGTCCAGGCTGCGNGCGCTGCTGGGNCTCGGGCTGCTG
HKR069778 ARe74H10 pKA1U5 NM_144772.2  
GGCTCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTCGGGCTGCTGGTTGCG
HKR205277 ARiS013D05 pGCAP10 NM_144772.2  
GGCGCGCTCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTCGGGCTGCTGGT
HKR260001 ARiS150A01 pGCAP10 NM_144772.2  
GGCTCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTCGGGCTGCTGGTTGCG
HKR462644 RBdS156K04 pGCAP10 NM_144772.2  
GCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTCGGGCTGCTGGTTGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl