Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K04

Clone ID RBdS156K04
HP ID HP02929
Gene ID 128240
Gene Symbol APOA1BP
Protein Name apolipoprotein A-I binding protein
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_144772.2
Length of RefSeq (bp) 1121
Chromosome 1q22-q21.2
Reference DDBJ accession
UniGene Hs.528320
5'-terminal sequence GCTGCGAGCTGGATGTCCAGGCTGCGGGCGCTGCTGGGCCTCGGGCTGCTGGTTGCGGGC
2011.08.28