Prev. |  KEGG KO K20821 > 

RIKEN DNA Bank Human Resource - BORCS7

Gene ID NCBI Gene 119032 |  KEGG hsa:119032
Gene Symbol BORCS7
Protein Name BLOC-1 related complex subunit 7
Synonyms C10orf32
Ortholog resource in our bank

  BORCS7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095470 IRAL038L06 pDNR-LIB BC015994 NM_144591 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019455 W01A048K15 pENTR-TOPO IRAL038L06 BC015994 NM_144591  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041345 ARe03G01 pKA1U5 NM_144591.3  
ATCCTGGCCCGGCGACTCACCATCGTCAGTGCGCAACCGTTCGCTAACTGAAATGATGGC
HKR175723 ARi39F03 pGCAP10 NM_144591.3  
GAGTGCGCAACCGTTCGCTAACTGAAATGATGGCGACTGGAACGCCAGAGTCTCAAGCGC
HKR366956 RBd17G12 pGCAP10 NM_144591.3  
GGCCAGGCCTGGTGGCTCACTCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGCGGA
HKR474998 RBdS187I06 pGCAP10 NM_144591.3  
GGAAATGATGGCGACTGGAACGCCAGAGTCTCAAGCGCGGTTCGGTCAGTCCGTGAAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl