Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187I06

Clone ID RBdS187I06
HP ID HP04618
Gene ID 119032
Gene Symbol C10orf32
Protein Name chromosome 10 open reading frame 32
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_144591.3
Length of RefSeq (bp) 1653
Chromosome 10q24.32
Reference DDBJ accession
UniGene Hs.34492
5'-terminal sequence GGAAATGATGGCGACTGGAACGCCAGAGTCTCAAGCGCGGTTCGGTCAGTCCGTGAAGGG
2011.08.28