Prev. |  KEGG KO K05214 > 

RIKEN DNA Bank Human Resource - GRIN3B

Gene ID NCBI Gene 116444 |  KEGG hsa:116444
Gene Symbol GRIN3B
Protein Name glutamate ionotropic receptor NMDA type subunit 3B
Synonyms GluN3B|NR3B
Ortholog resource in our bank

  GRIN3B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR375297 RBd38E01 pGCAP10 NM_138690.1 VA done
GGGAACCTGGCCGGGGCCCTCCACCCGCGCCGTGGTCCCGGTGGTTGCGCCCCGTGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl