Prev. |  Human A to Z list >  G >  GRIN3B > 

RBd38E01 - NRCD Human cDNA Clone

Catalog Number HKR375297
Clone Name RBd38E01
Clone info. Plasmid clone of human GRIN3B cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGGAACCTGGCCGGGGCCCTCCACCCGCGCCGTGGTCCCGGTGGTTGCGCCCCGTGGCGA
Sequence, submitted(3) n.a.
Note match to NM_138690.2 (1-3101,3128-3273) CDS:full/var
 
Sequence, refered NM_138690.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) GRIN3B (NCBI Gene 116444)  other clone of GRIN3B in our bank
Synonyms GluN3B|NR3B
Protein Name glutamate ionotropic receptor NMDA type subunit 3B
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR375297 RBd38E01 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd38E01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR375297).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBd38E01a.seq   RBd38E01c.seq RBd38E01z.seq RBd38E01.pdf

References and tips

Featured content

Reference

user_report Matsuno, H., A Naturally Occurring Null Variant of the NMDA Type Glutamate Receptor NR3B Subunit Is a Risk Factor of Schizophrenia. PLoS One 10 (3): e0116319 (2015). PMID 25768306.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl