Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C12orf57

Gene ID (NCBI) 113246
Gene Symbol C12orf57
Protein Name chromosome 12 open reading frame 57
Synonyms C10|GRCC10|TEMTYS
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084556 IRAL011G12 pOTB7 BC009925 NM_138425

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR072026 ARe80B02 pKA1U5 NM_138425.2
GGCTGTTTCCTTTCCGCTCCCAGGGGCGTTGGGAACGGTTGTAGGACGTGGCTCTTTATT
HKR371674 RBd29D02 pGCAP10 NM_138425.2
GACGGTTGTAGGACGTGGCTCTTTATTCGTGAGTTTTCCATTTACCTCCGCTGAACCTAG
HKR416335 RBdS040N23 pGCAP10 NM_138425.2
GGGCTGCGCCGGATGCTGTTTCCTTTCCGCTCCCAGGGGCGTTGGGAACGGTTGTAGGAC
HKR441720 RBdS104E24 pGCAP10 NM_138425.2
TGGGGTTGTAGGACGTGGCTCTTTATTCGTGAGTTTTCCATTTACCTCCGCTGAACCTAG
HKR441893 RBdS104M05 pGCAP10 NM_138425.2
TGGGGTTGTAGGACGTGGCTCTTTATTCGTGAGTTTTCCATTTACCTCCGCTGAACCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl