Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040N23

Clone ID RBdS040N23
HP ID HP05724
Gene ID 113246
Gene Symbol C12orf57
Protein Name chromosome 12 open reading frame 57
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138425.2
Length of RefSeq (bp) 574
Chromosome 12p13.31
Reference DDBJ accession
UniGene Hs.591045
5'-terminal sequence GGGCTGCGCCGGATGCTGTTTCCTTTCCGCTCCCAGGGGCGTTGGGAACGGTTGTAGGAC
2011.08.28