Prev. |  KEGG KO K20636 > 

RIKEN DNA Bank Human Resource - ARHGAP12

Gene ID NCBI Gene 94134 |  KEGG hsa:94134
Gene Symbol ARHGAP12
Protein Name Rho GTPase activating protein 12
Synonyms -
Ortholog resource in our bank

  ARHGAP12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044384 IRAK110P24 pCMV-SPORT6 BC051811 NM_018287 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174453 ARi36C05 pGCAP10 NM_018287.5  
GAGGCCAGCCTGCGGGGACGGGCCGGCCGCGGCCGTAGCCGTGTGAACGCTCTTCGGGCT
HKR461815 RBdS154I23 pGCAP10 NM_018287.5  
GGAGCCCCGCCCCCGCGCCGGCGCGCTCCGACGTGCCCTGTAACTTACCCTCCCTCAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl