Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154I23

Clone ID RBdS154I23
HP ID HP07735
Gene ID 94134
Gene Symbol ARHGAP12
Protein Name Rho GTPase activating protein 12
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_018287.5
Length of RefSeq (bp) 4172
Chromosome 10q11.22
Reference DDBJ accession
UniGene Hs.499264
5'-terminal sequence GGAGCCCCGCCCCCGCGCCGGCGCGCTCCGACGTGCCCTGTAACTTACCCTCCCTCAGAG
2011.08.28