Prev. | 

RIKEN DNA Bank Human Resource - TEX30

Gene ID NCBI Gene 93081 |  KEGG hsa:93081
Gene Symbol TEX30
Protein Name testis expressed 30
Synonyms C13orf27
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013475 IRAK033L11 pBluescriptR BC015148 NM_138779

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182923 ARi57F03 pGCAP10 NM_138779.3  
GGTAGCCGAACGCTGTGGCGGGGCAGGCGAGGCGGTCGCTTCGAGCGCGCTAGTCAGCTC
HKR341659 RBb54C11 pGCAP1 NM_138779.3  
GAGTCAGCTCCCTGAAGGGAGTGACGGCGGTTGGGTGCCCGCGGCCACTTTTGCCTTCCC
HKR461696 RBdS154D24 pGCAP10 NM_138779.3  
GAGGCGAGGCGGTCGCTTCGAGCGCGCTAGTCAGCTCCCTGAAGGGAGTGACGGCGGTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl