Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154D24

Clone ID RBdS154D24
HP ID HP06247
Gene ID 93081
Gene Symbol C13orf27
Protein Name chromosome 13 open reading frame 27
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138779.3
Length of RefSeq (bp) 1177
Chromosome 13q33.1
Reference DDBJ accession
UniGene Hs.398111
5'-terminal sequence GAGGCGAGGCGGTCGCTTCGAGCGCGCTAGTCAGCTCCCTGAAGGGAGTGACGGCGGTTG
2011.08.28