Prev. |  KEGG KO K17868 > 

RIKEN DNA Bank Human Resource - DPH7

Gene ID NCBI Gene 92715 |  KEGG hsa:92715
Gene Symbol DPH7
Protein Name diphthamide biosynthesis 7
Synonyms C9orf112|RRT2|WDR85
Ortholog resource in our bank

  DPH7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028016 IRAK070A16 pBluescriptR BC040173 NM_138778 Partial/var
HGY082480 IRAL006D08 pOTB7 BC003123 NM_138778 Full
HGY095743 IRAL039F23 pOTB7 BC017335 NM_138778 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219916 ARiS049N04 pGCAP10 NM_138778.2  
GGAGGCCGAAAGGCGCACCGAATCGCCCAGGAGATGAAGAGGGGATATTGGCCCTTTGGC
HKR409103 RBdS022M15 pGCAP10 NM_138778.2  
GGTCCGGCCGGCCCCGGCCTCGCCGCCCCGCGCAGTACCCAGCCCGGCCCCGCCGACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl