Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022M15

Clone ID RBdS022M15
HP ID HP07945
Gene ID 92715
Gene Symbol WDR85
Protein Name WD repeat domain 85
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138778.2
Length of RefSeq (bp) 1847
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.292570
5'-terminal sequence GGTCCGGCCGGCCCCGGCCTCGCCGCCCCGCGCAGTACCCAGCCCGGCCCCGCCGACCCG
2011.08.28