Prev. |  KEGG KO K01084 > 

RIKEN DNA Bank Human Resource - G6PC3

Gene ID NCBI Gene 92579 |  KEGG hsa:92579
Gene Symbol G6PC3
Protein Name glucose-6-phosphatase catalytic subunit 3
Synonyms SCN4|UGRP
Ortholog resources KEGG ortholog (KEGG orthology K01084) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081697 IRAL004E01 pOTB7 BC002494 NM_138387 Full
HGY096197 IRAL040I05 pOTB7 BC021574 NM_138387 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR069232 ARe73B08 pKA1U5 NM_138387.2  
GACTCTGGTTTCCGCCCTGGAGCAAGCCGGGGCCTGTATCGGCAGCTGGGCCGCCATGGA
HKR164850 ARi12C02 pGCAP10 NM_138387.2  
GGGGGTGGGCTTTGGAGATCAGAGGGTCGACGCTGCTTCGTTGCCTGGACTCTGGTTTCC
HKR177728 ARi44F08 pGCAP10 NM_138387.2  
GGACTCTGGTTTCCGCCCTGGAGCAAGCCGGGGCCTGGTCGGCAGCTGGGCCGCCATGGA
HKR235147 ARiS087O11 pGCAP10 NM_138387.2  
GGGGGTGGGCTTTGGAGATCAGAGGGTCGACGCTGCTTCGTTGCCTGGACTCTGGTTTCC
HKR276509 ARiS191E13 pGCAP10 NM_138387.2  
CGGCCGGCCGATGTTTCCGCCCTGGAGCAAGCCGGGGCCTGGTCGGCAGCTGGGCCGCCA
HKR369697 RBd24E01 pGCAP10 NM_138387.2  
GAGAGCGCAGGAGGAAACAGTACCGGCTGGAGGCCGGTCTTGCAGGAGCGGGGGACTGCT
HKR416049 RBdS040C01 pGCAP10 NM_138387.2  
GCCTGGACTCTGGTTTCCGCCCTGGAGCAAGCCGGGGCCTGGTCGGCAGCTGGGCCGCCA
HKR430136 RBdS075F16 pGCAP10 NM_138387.2  
GGGAGCAAGCCGGGGCCTGGTCGGCAGCTGGGCCGCCATGGAGTCCACGCTGGGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl