Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075F16

Clone ID RBdS075F16
HP ID HP03625
Gene ID 92579
Gene Symbol G6PC3
Protein Name glucose 6 phosphatase, catalytic, 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138387.2
Length of RefSeq (bp) 1558
Chromosome 17q21.31
Reference DDBJ accession
UniGene Hs.294005
5'-terminal sequence GGGAGCAAGCCGGGGCCTGGTCGGCAGCTGGGCCGCCATGGAGTCCACGCTGGGCGCGGG
2011.08.28