Prev. |  KEGG KO K19737 > 

RIKEN DNA Bank Human Resource - PRMT9

Gene ID NCBI Gene 90826 |  KEGG hsa:90826
Gene Symbol PRMT9
Protein Name protein arginine methyltransferase 9
Synonyms PRMT10
Ortholog resource in our bank

  PRMT9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085364 IRAL013G20 pOTB7 BC004337 NM_138364 Partial
HGY095609 IRAL039A09 pOTB7 BC021250 NM_138364 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096016 M01C040A16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096064 M01C040C16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096112 M01C040E16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096160 M01C040G16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096208 M01C040I16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096256 M01C040K16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096304 M01C040M16 pDONR221 MGC09-F08 BC064403 NM_138364  
HGE096352 M01C040O16 pDONR221 MGC09-F08 BC064403 NM_138364  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR453093 RBdS132M05 pGCAP10 NM_138364.2  
AGCAAGAGAAGTGATAAGAGAGGCACAGTCAACATATAGGAGGCAAACATGGATGATGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl